pooooooooyp3235 pooooooooyp3235
  • 04-09-2017
  • Business
contestada

A. patel is single and gives each of his six grandchildren $30,000 this year. patel's gift tax exclusion is

Respuesta :

ahmedishaal ahmedishaal
  • 12-09-2017
According to annual gift tax exemption you are allowed to make gifts of up to $14,000 per year per person which is tax-free. Now Patel gave his six grand children $30,000 each. So, Patel's gift tax exclusion on each individual is $14,000.  The amount above the annual limit that is $14,000 to each individual has to be reported and counts toward Patel’s lifetime exclusion.
Answer Link

Otras preguntas

What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
How many years does an apple tree live useful?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what are 2 examples of ionic compound?
What is the range of function of y-1=(x+3)^2
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
the temperature of a sample of matter is a measure of the ?