ash24 ash24
  • 03-04-2015
  • Biology
contestada

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Respuesta :

flyingcaprinekid
flyingcaprinekid flyingcaprinekid
  • 04-04-2015


the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Otras preguntas

which sum or difference is equivalent to the following expression 2x 3/4 a. x/2 3/4b. x/2 - 3/4c. 3x/4 3/4d. 8x 24
what is a chairaistic of a folk tale
a vendor makes a new smartphone and presells four thousand units for $300 each. the factory has the capacity to produce one thousand smartphones per month. anti
The sales tax on a purchase of $56 is 7.5%. What is the total purchase price, including the sales tax
1. For which is a chart legend used? a. all of the time b. whenever you are comparing data that is the same c. whenever you
Many modernist writers were deeply affected by the horrors of world war ii, particularly the bombings of hiroshima and nagasaki. the possibility of russian worl
a circuit contains two devices that are connected in parallel. if the resistance of one of these devices is 12 ohms and the resistance of the other device is 4
A satellite camera takes a​ rectangle-shaped picture. The smallest region that can be photographed is a 22​-km by 66​-km rectangle. As the camera zooms​ out, th
Enzymes are vital to _____ for reactions in living organisms. lowering the required activation energy providing food transporting oxygen
a possible answer to a scientific question or explanation for a set of observations what is the vocab word