rosabanton rosabanton

02-03-2015
History

contestada

Which of the following most directly caused the decline in the Cretan and Mycenaean civilizations

Respuesta :

ReadingAddiction510 ReadingAddiction510

02-03-2015

A huge volcano erupted and caused the fall of civilizations all around the Mediterranean, including the Cretan and Mycenaean civilizations. This is the most popular theory, at least.

Answer Link

Otras preguntas

Write expression using the distributive property to find the product of 7 times 63

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.

(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right

Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?

Companies raise funds to expand their business by