lizethllucio lizethllucio
  • 04-10-2021
  • Mathematics
contestada

Divide. check your answer

. _____
28) 676


The quotient is _____ and the remainder is ____

Respuesta :

miam75811 miam75811
  • 04-10-2021

Step-by-step explanation:

:)..................

Ver imagen miam75811
Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
why is the square root of a perfect square always rational
Why did the french revolution happen and who's fault was it
the reproductive system of a male mammal provides
What does hemostasis mean?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.