mayaxmatzrblx mayaxmatzrblx
  • 03-09-2021
  • Mathematics
contestada

There are four quarters in a dollar. How many quarters are there in five dollars?

Respuesta :

jwu4444 jwu4444
  • 03-09-2021

Answer:

20 quarters in five dollors

Step-by-step explanation:

4 x 5 = 20

Answer Link
fallsky236 fallsky236
  • 03-09-2021

Answer:

20 quarters

Step-by-step explanation:

4 = 1 dollar

4 +4 +4 +4 + 4 =20

Answer Link

Otras preguntas

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
How many times does four go into 153 ? What Is the remainder ?
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
what is the lcd of 10/11,29/44
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A light bulb converts electrical energy into electromagnetic energy is true or false?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
How do I do trebuchet calculations????? Help me please