itzparrighuman
itzparrighuman itzparrighuman
  • 03-09-2021
  • Mathematics
contestada

raven is making pillows. each pillow needs 3/5 card of fabric. raven has 6 yards. how many pillows can she make?

Respuesta :

rspill6
rspill6 rspill6
  • 03-09-2021

Answer:  10 pillows

Step-by-step explanation:  

[(3/5) yard/pillow]

6 yards

(6 yards)/(3/5 yard/pillow) - 10 pillows

Answer Link

Otras preguntas

i need help with #3
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
a antonym for biosphere
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
How many years does an apple tree live useful?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo