ananyagadepalli ananyagadepalli
  • 02-08-2021
  • Mathematics
contestada

In isoceles triangle the length of a leg is 17cm, and the base is 16cm. Find the length of the altitude to the base

Respuesta :

Аноним Аноним
  • 02-08-2021

This triangle has base 16 therefore the sides must be 17cm and 17 cm

When we make a altitude it divides it into two right triangles and there is a property in which the altitude of the isoceles triangle divides the base in 2 equal halves

So the side of the right triangle will be x , 8 , 17

Using pythgoreus theorem

x²+8²=17²

x = √225

x = 15

So the altitude is 15 cm

Must click thanks and mark brainliest

Answer Link

Otras preguntas

How do you put allele in a sentence
What kind of problems did increased urbanization cause? During time of industrial revolution
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Graph the first six terms of a sequence where a1 = -10 and d = 3.
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
How has water influenced the development of civilization in Africa
Is 5/7 greater than 4/6
what are 2 points on the graph for 6x-5y=25