SophiaOlguine333 SophiaOlguine333

04-06-2021
Mathematics

contestada

can someone help me on this question i don't know if im correct I would appreciate it.

can someone help me on this question i dont know if im correct I would appreciate it class=

Respuesta :

jimthompson5910 jimthompson5910

04-06-2021

Answer: You are correct. The answer is B) 118 degrees

Nice work.

To get this answer, you simply subtract the given angle from 180

180-62 = 118

This is because angles RSU and UST are supplementary, as they form a straight line.

Answer Link

Otras preguntas

Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for

Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

what was paul revere failures

In which system of government would states function independently of each other?

an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the

A generator stores electric current. Explain why you agree or disagree with this statement

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12

Why did the french revolution happen and who's fault was it