hjstu99k4f
hjstu99k4f hjstu99k4f
  • 01-05-2021
  • Mathematics
contestada

helppppppppppppppppppppppppppp

helppppppppppppppppppppppppppp class=

Respuesta :

Аноним Аноним
  • 01-05-2021

Since there are three sides and they're all 1 cm, the perimeter would be 3cm.

Then do 77x3cm=231cm

Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what rule does static electricity follow