caroctefanyhe
caroctefanyhe caroctefanyhe
  • 02-10-2016
  • Mathematics
contestada

what is 91 divided by 2,912

Respuesta :

oliviaaractingi
oliviaaractingi oliviaaractingi
  • 02-10-2016
.03125 is your answer to 91/2912
Answer Link

Otras preguntas

Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
How much money, in dollars, does one mole of nickels represent?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
A light bulb converts electrical energy into electromagnetic energy is true or false?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?