jo360 jo360
  • 03-11-2020
  • Mathematics
contestada

Given the function f(x) = 5x, Section A is from x = 0 to x = 1 and Section B is from x = 2 to x = 3. Part A: Find the average rate of change of each section.

Respuesta :

Roacheisis Roacheisis
  • 04-11-2020

Answer:

The answer is 1.5 / 6

Step-by-step explanation:

The reason why I think is 1.5 / 6 is because 6 * 5 -7 * 8 equals 9.00 0.5 which in mathematical terms would be 1.5 / 6

Answer Link

Otras preguntas

What was George Washington's nickname?
How much money, in dollars, does one mole of nickels represent?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
2ln(5x)=8 solve for x
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
does a human body use neon???
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Which body tissue or organ contains the most mitochondria?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.