Seudónimo Seudónimo
  • 01-09-2020
  • Mathematics
contestada

D is between C and E, CD = x 2 , CE = 32-2x, and DE = 12x. Find CD, DE, and CE.

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 02-09-2020

Answer:

  • CD = 4
  • DE = 24
  • CE = 28

Step-by-step explanation:

The segment addition theorem tells you ...

  CD +DE = CE

  x^2 +12x = 32 -2x

Subtract the right side to put this in standard form.

  x^2 +14x -32 = 0

  (x +16)(x -2) = 0

  x = -16 or 2

In order for DE to have a positive length, we must have x > 0. So ...

  CD = x^2 = 2^2 = 4

  DE = 12x = 12(2) = 24

  CE = 32 -2x = 32 -2(2) = 28

Answer Link

Otras preguntas

3+1/4x greater than 11
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
the perimeter of a square 116ft ?
How many times does four go into 153 ? What Is the remainder ?
the perimeter of a square 116ft ?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?