erica10 erica10
  • 01-03-2016
  • Mathematics
contestada

is 27 a prime or composite

Respuesta :

Inaara
Inaara Inaara
  • 01-03-2016
Prime numbers are numbers that can only be factored by one and itself. Since 27 has factors: 1,3,9, and 27, it is a composite number 
:)
Answer Link
SmarticalParticals
SmarticalParticals SmarticalParticals
  • 01-03-2016
Prime numbers are only divisible by that number and 1. 27 is divisible by 27 and 1, but it is also by 3 and 9 so it is composite.
Answer Link

Otras preguntas

How well did feudalism establish order in the Middle ages?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
round 7,782 to the nearest hundred
Companies raise funds to expand their business by
what rule does static electricity follow
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
31+34=90-n 45+1=70-k 6×9=41+m