Seudónimo Seudónimo
  • 02-09-2015
  • Social Studies
contestada

how might an archaeological site be found by chance

Respuesta :

WorldCitizen WorldCitizen
  • 02-09-2015
There are many ways it can be discovered by chance : someone might be passing by and finD an object which would raise archeologists' interest, one might  be doing plumbing and stumble upon something unexpected  or one might be taking aerial pictures and discover a regular pattern, pointing to an old settlement. 
Answer Link

Otras preguntas

select th An isotope of uranium contains 92 electrons, 92 protons, and 140 neutrons. The notation for this isotope is
during a first quarter moon, when is high tide.
I can't remember exactly how long I worked at the mall, but I can call to find out. What is the weakness in this sentence? A. The candidate appears to be unreli
A hockey card collector opens a drawer of sorted cards and, after selecting a random starting point, takes out every fifth card. Which type of random sampling i
Percentages! Just complete the sentance
Gavyn rolls a fair dice 540 times. How many times would Gavyn expect to roll a four?
3) Given the isosceles triangle below, what is the measure of angle A?
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
The percents of students who travel to school by car, bus, and bicycle are shown for a school of 825 students. a. Write the percents as decimals. Car: School
5x=72? A true or false question by my teacher! I need answers T-T