operagamer3 operagamer3
  • 03-02-2024
  • English
contestada

what is an mouse for stranger sthing.​

Respuesta :

unishbaskota
unishbaskota unishbaskota
  • 03-02-2024

Answer:

It is word

good try please ask mkre quwstion

Answer Link

Otras preguntas

(1 point) A computer retail store has 8 personal computers in stock. A buyer wants to purchase 4 of them. Unknown to either the retail store or the buyer, 4 of
Analysis of Receivables Method: At the end of the current year, Accounts Receivable has a balance of $3,750,000, Allowance for Doubtful Accounts has a credit b
8. Unlike DNA, RNA O A. has deoxyribose as the sugar within its nucleotide components. OB. contains two strands wrapped in a helix. OC. contains nitrogenous bas
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
Worldwide​ Wholesalers, Inc. has decided that instead of having its employees manage its raw materials​ inventory, it will pay its suppliers to store and delive
Our goal here is to predict whether an accident just reported will involve an injury (MAX_SEV_IR = 1 or 2) or will not (MAX_SEV_IR = 0). For this purpose, creat
Which function is increasing?
What is the slope of y=17x
According to Fodor, in the functionalist view the psychology of a system depends not on the stuff it is made of but on _____. A. what psychologists say about th
Find the measure of Arc JNFind the measure of arcJN= Find the m