AlectoWarbanks
AlectoWarbanks AlectoWarbanks
  • 02-05-2017
  • Biology
contestada

List three reasons animals move from place to place (this is a stupid question but I unfortunately need a scientific answer)

Respuesta :

392571
392571 392571
  • 02-05-2017
animals move from place to place because -

1)in search of food and shelter.
2)to protect themselves against adverse climatic conditions.
3)to protect themselves 
from enemies and their predators
4)to find suitable partners for reproduction.

Animals migrate to reproduce, eat, or seek warmer climates.


Answer Link

Otras preguntas

A tree has a specific density. If we were to cut the tree in half, what would happen to the density?
Find the distance between the two points rounding to the nearest tenth (if necessary). (-1,51 and (-7, -1) ​
drilling concrete requires use of a respirator because it produces:
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Genes do not affect more than our physical characteristics True False
Pleaseeeeee help?????????????????
0.2(-4–2.5b–7c). write the product
I need help with French can someone answer these?:) -Use the photo-
11. When light bounces off of a surface, we call it: absorption reflection refraction transmission
Which number sentence is true?