rjirroororor rjirroororor
  • 02-05-2017
  • Mathematics
contestada

Helpppppppppppp.!!!!!!!!!!!!

Helpppppppppppp class=

Respuesta :

Gänseblümchen
Gänseblümchen Gänseblümchen
  • 02-05-2017
Yes both rates are equivalent
Answer Link
Bbjayrichboy
Bbjayrichboy Bbjayrichboy
  • 02-05-2017
They are equivalent because 30 can go in 90 and 20 go into 60
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall
why is the inner mitochondrial membrane folded
Remembering how to ride a bicycle, even though you have not ridden one for years, is an example of _____ memory.
Illinois senator who believed slavery question should be settled by popular sovereignty
Why is the epa considered to be one of the most powerful bureaucracies?
why did the church oppose the heliocentric theory
Racing other drivers, tailgating, and attempting to beat a train to a railroad crossing are possible consequences of __________ when driving while impaired. A.
A promissory note Question 12 options: is a written promise to pay. is an oral promise to pay. entitles the maker to a discount. is due in 30 days.
Find f(x) if it is known that f(x−2)=2x−4.