alexander3 alexander3
  • 03-03-2015
  • Social Studies
contestada

how many colonies were founded in the 1620's?

Respuesta :

Аноним Аноним
  • 03-03-2015
there was 178 colonies found in the 1620s
Answer Link

Otras preguntas

In which sentence does the underlined noun clause function as the object of a preposition. Our group sends whoever requests information a newsletter and a link
A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.
the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim
The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?
What was a major effect of the agricultural revolution in the united states during the late 1800's?
(50)points 5 questions!
Why did the United States go to war with Britain in 1812
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?
The available farmland in Mali is in the northeast. True or false