kingxpgoat
kingxpgoat kingxpgoat
  • 02-04-2022
  • English
contestada

how does liquid water evaporate into the air​

Respuesta :

Chaexry
Chaexry Chaexry
  • 02-04-2022

Answer:

When water is heated, it evaporates.

Explanation:

The molecules move and vibrate so quickly that they escape into the atmosphere as molecules of water vapor.

Hope it helps you

TC

have a great time

Answer Link

Otras preguntas

A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for
A man has blood type AB and his wife has blood type B. What are the possible blood types for their child
What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2
How do the structures of alveoli and capillaries support the function of gas exchange?
(50)points 5 questions
which combination of quarks produces a neutral baryon
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Two boys on bicycles start cycling from the same place at the same time. one cyclist travels 15 miles per hour, the other travels 12 miles per hour, if they tra
Why did the United States go to war with Britain in 1812
When the net is folded into the rectangular prism shown beside it, which letters will be on the front and back of the rectangular prism? Question 7 options: The