unlikejackii3 unlikejackii3

02-12-2021
Chemistry

contestada

please help! you’ll be marked brainliest

please help youll be marked brainliest class=

Respuesta :

ruby20051 ruby20051

02-12-2021

Answer:

Number of Protons:

Co: 27

Cl: 17

K: 19

S: 16

Al: 13

P: 15

Number of Electrons:

Co: 25

Cl: 18

K: 18

S: 18

Al: 10

P: 18

Answer Link

Otras preguntas

What is Seth gordins overall message to marketers?

the government of the articles of confederation was successful in resolving the problem of how to

Please help will give Brainlist if correct

● How does this painting relate to the concept of unalienable rights? Equal rights?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Part B Substitute 5, 3.4, and 4 Into the equation from question 1, part A. Which of these values result in a valid equation?

Three kg of gas in a piston–cylinder assembly undergo a process during which the relationship between pressure and specific volume is Pv0.5=constant. The proces

Distinguish between evolution and naturalselection.

net force and acceleration

who defended the british soldiers involved in the boston massacre