marieXJojNef2 marieXJojNef2

04-01-2017
Mathematics

contestada

Austin has answered 21 of the 25 questions. what percent of the questions has he answered?

Respuesta :

yop1010 yop1010

04-01-2017

Since 100=25×4. We simply multiply 21×4= 84%
Answer: Austin answered 84% of the questions.

Hope this helps! :)

Answer Link

Otras preguntas

A major problem facing italy after its unification was select one: a. papal interference in political elections b. the uneven economic development of the north

Joseph and cleoma, who made the first cajun recording, were husband and wife

The oxygen moves into the blood system from the lungs by the process. A.Exhalation B.Osmosis C.Diffusion D.Respiration

Asexual reproduction _____. see concept 13.1 (page 255) asexual reproduction _____. see concept 13.1 (page 255) leads to a loss of genetic material requires bo

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

Bartók's Concerto for Orchestra is written for A. full orchestra and singer. B. string quartet and orchestra. C. full orchestra. D. full orchestra

Why would a signature item, such as distinctive button or tag, be considered a need even if it was not essential to the item’s function? -f someone powerful in

A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?

What is the difference between a settler an an explorer social studies?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat