nguyettam2233
nguyettam2233 nguyettam2233
  • 02-11-2021
  • Social Studies
contestada

help me plss
Write an international event that interests you most to express your personal opinion about 400-500 words

Respuesta :

stephaniehecker stephaniehecker
  • 02-11-2021

Answer:

Not possible

Explanation:

The essay you are to write is your own opinion and since there is no one else like you, it is simply not possible to write for you what can be written by you.

What I suggest is that you look at international events and pick one that truly interests you and write about it.  You'd be surprised how much better it is to write in your own words than to have someone else pick an event and write it for you.  

Answer Link

Otras preguntas

how did u get the area of the trapezoids tho.
Water vapor is a gas in the atmosphere that helps make clouds and precipitation. __________ is the temperature the air needs to be cooled to in order to achieve
When naming the second nonmetal in a covalent molecule, the numerical value is indicated by a __.
what is the solution and the graph and the inequality ​
Someone help me ASAP
Even though many people realize the power of routine physical exams, they are hesitant to schedule. What factors may impact a patient’s compliance-following thr
Which of the following caused the Great Migration of the early 1900s?
What is the probability of rolling an even number on a number cube and flipping a head with a fair coin?
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
help is neededdddddd