echo67484 echo67484

03-06-2021
English

contestada

In the book thief, what finally made everyone in the shelter calm

Respuesta :

Аноним Аноним

03-06-2021

Answer:

Liesel starts reading The Whistler aloud.

Slowly, the noise in the shelter quiets down as everyone gathers around to listen to her read. After a while, she notices that her reading to the people is like Hans's accordion to her.

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

pls help me its due rn it would mean alot if you can please and ttyy

Elizabeth shipped 6 cases of rubber bands that weighed 3 and 5/8 pounds each. What was the total weight of rubber bands shipped?

Our school had a pizza party.The school ordered 847 slices of pizza for the party. The students ate 628 slices. How many slices of pizza are left over?

Use mental math to find the sum of 43 and 57

According to the United Nations' stages of economic development for classifying countries with respect to levels of industrialization, which category does an in

_______is sediment that is as fine as talcum powder.

A 1.50-kg iron horseshoe initially at 550°C is dropped into a bucket containing 25.0 kg of water at 20.0°C. What is the final temperature of the water–horseshoe

Circle T has diameters RP and QS. The measure of ∠RTQ is 12° less than the measure of ∠RTS. Circle T is shown. Line segments T S, T R, T Q, and T P are radii. L

How do you solve (9-6y)