makalahs734 makalahs734

02-04-2021
Mathematics

contestada

Which order pairs is the solution to the system of the equations?

A. (4, 10)
B. (10, 4)
C. (6, 2)
D. (2, 6)

Which order pairs is the solution to the system of the equations A 4 10 B 10 4 C 6 2 D 2 6 class=

Respuesta :

imbadatmathlol99 imbadatmathlol99

02-04-2021

I have the same question lol

Answer Link

Otras preguntas

“If Today were Sunday, we wouldn’t go to school.” They said to me, She said to me, “If I were you, I wouldn’t tell her about this.” “There would not be enough

I was eating lunch at school, and someone stole my wallet. I don't know who did, but I am mad and sad. What should I do?

Help please? I'm not really sure what to do here.

Write the equation of the line that is parallel to the line 2x + 5y = 15 and passes through the point (-10, 1)

What happened to the steel workers union members?

A sample of metal has a mass of 24.64 g, and a volume of 5.91 mL. What is the density of this metal?

What are the protein molecules that make possible chemical reactions in living things.

2x+4=-2 What value of x is the solution to the equation

njeri a business lady paid sh 500 after getting a discount of sh 100. What was the percentage discount.

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'