sackoahmed96 sackoahmed96

02-04-2021
Mathematics

contestada

Jeremiah ran 5.6 miles every day for
2 weeks. How many miles did he run
in all?

Respuesta :

cookiebrookie07 cookiebrookie07

02-04-2021

Answer:

78.4 miles

Step-by-step explanation:

Since there are 14 days in two weeks, you multiply 5.6 miles times 14 days to get 78.4 miles in total since 5.6 is how much he ran every DAY

Answer Link

Otras preguntas

what is r in this equation? πr^2=42π

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which section of an article would you look at to find out if assessors were blinded to treatment assignment?

Given that A=xy find the percentage increase in A when both X and Y increase by 10%

PLEASE HELP ME !!!!!!!!!! I BEG YOU !!!!!! PLEASE HAVE MERCY !!!! Use I = PRT to solve I = $350 P= $700 Find T (TIME IN YEARS) R

great Britain is an example of a core nation True or False

Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions

Why is the epa considered to be one of the most powerful bureaucracies?

which item below is part of the circulatory system a. kidneysb. lungsc. heart or d. stomach