aaronbrittany1031
aaronbrittany1031 aaronbrittany1031
  • 02-03-2021
  • Mathematics
contestada

3/8 - 1/8 pls answer dis

Respuesta :

amoymckenzie011 amoymckenzie011
  • 02-03-2021

Answer:

The answer for this question is 1/4

Answer Link
mina136 mina136
  • 02-03-2021

Answer:

1/4

Step-by-step explanation:

Answer Link

Otras preguntas

Please help me out with this
What is the elapsed time
15 points to whoever can answer this question!!!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height ( meter
Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Hallucinogens can cause __________. A. extremely high speed B. slowing down or stopping in the middle of a freeway C. heightened focus on the driving task D. A
Which constitutional amendment allowed voting for citizens who were eighteen or older?
will give thanks and brainliest What is an informed opinion? an opinion that you agree with an opinion that you don’t agree with an opinion that can be argued
Can someone Help me with that please
A carpenter is making a blanket chest based on an antique chest. Both chests have the shape of a rectangular prism. The length width and height of the new chest