anahivillarreal15 anahivillarreal15

01-02-2021
Mathematics

contestada

If p= -7 and r = 1/2, what does pr - r equal

A) -4
B) -3
C) 3
D) 4

If p 7 and r 12 what does pr r equal A 4 B 3 C 3 D 4 class=

Respuesta :

01-02-2021

Answer:

Step-by-step explanation:

Factor the expression.

pr - r = r(p-1) = ½(-8) = -4

Answer Link

capsasha2 capsasha2

01-02-2021

Answer:

-4

Step-by-step explanation:

pr = -7 × 1/2
-7 × 1/2 = -3.5
-3.5 - r = -3.5 - 1/2
-3.5 - 1/2 = -3.5 - 0.5
-3.5 - 0.5 = -4

I hope this helps!

Answer Link

Otras preguntas

2 HBr(g)+O2(g)—>H2O2(g)+Br2(g) Based on a kinetics study of the reaction represented by the equation above, the following mechanism for the reaction is propo

Solve each equation by factoring. x^2 + 3x + 2 = 0

i need help on number 30. ASAP/ whoever answers first gets brainliest

if 3,a-1,a+1 and 5 are pproportional,then a =?

9 t-shirts and a hat costs £93.00 4 t-shirts and a hat cost £43.00. How much does a t-shirt cost? How much does a hat cost? points and brainlist if you can expl

Help me please its really confusing

Multiply (-4)(-2)(-5). -40 -8 08 40

How many times larger is the value 250,000 then 250

What type of malicious software tries to gather information about you without your consent? Select one: a. Spyware b. Viruse c. Malware d. Ransomware

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU