mnnunez
mnnunez mnnunez
  • 04-01-2021
  • Mathematics
contestada

Write 2 and 7/100 in decimal form

Respuesta :

25lockr 25lockr
  • 04-01-2021

Answer:

2.0 and 0.07   or 2.07

Step-by-step explanation:

hope this helps :)

Answer Link

Otras preguntas

What is skeletal connective tissue? Give its function
Solving this question
Why is global warming an issue to organisms or speices? How could the high human population growth rate drive further extinctions of plants and animals?
the influence of Greek and Roman culture on some Renaissance art is reflected in what
the organ procurement and transplant network divides the united states into geographic regions
why is the inner mitochondrial membrane folded
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the domain of the this function?
Toco el piano _______________ hace dos meses. desde se les por
You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome