abdullahone062 abdullahone062

01-07-2020
Mathematics

contestada

Simplify as much as possible?
3 (6-12)

Respuesta :

freddiemarchant freddiemarchant

01-07-2020

Answer:-18

Step-by-step explanation:

Answer Link

Stefany333 Stefany333

01-07-2020

Answer: -18

Explanation:

3(6-12)
3(-6)
= -18

Please mark as brainliest!

Answer Link

Otras preguntas

Which function represents a reflection of f(x) = Three-sevenths(2)x over the x-axis? g(x) = –Three-sevenths(2)x g(x) = Three-sevenths(–2)x g(x) = Three-sevenths

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Item 19 The scale on a map is 1 cm:30 mi. The distance on the map between San Francisco, CA, and Chicago, IL, is 61.9 cm. What is the actual distance between Sa

F(x)=x2−x−1f, left parenthesis, x, right parenthesis, equals, x, squared, minus, x, minus, 1 What is the average rate of change of fffover the interval -1\leq x

Which expression is equivalent to 83⋅ 8−7

An angle measures 106° more than the measure of its supplementary angle. What is the measure of each angle?

What is the molarity of 0.65 mol NaF dissolved in a total volume of 0.50 liters?

Please use Gauss’s law to find the electric field strength E at a distance r from the center of a sphereof radius R with volume charge density ???? = cr 3 and t

List 3 similarities and differences culture between lebanon and india

How might this insect's appearance help keep it from getting eaten?