episodediamond13
episodediamond13 episodediamond13
  • 02-12-2019
  • Mathematics
contestada

What is the length of CD in the figure below? Show your work.

What is the length of CD in the figure below Show your work class=

Respuesta :

DaGreatPotato DaGreatPotato
  • 02-12-2019

Answer:

5

Step-by-step explanation:

First, notice that these two triangles are similar using AA.

Because sides BC and EC are corresponding, you can divide 24 by 8, to determine that the ratio of similitude is 3.

That means that because sides AC and DC are corresponding, 25 - 2x divided by x is 3.

25 - 2x / x = 3

25 - 2x = 3x

25 = 5x

x = 5

x is the same as side CD, so CD = 5.

Answer Link

Otras preguntas

Just solve please and explain if you can
Its C. Explanation: edge2021
How was Sumerian society organized
Which government agency primarily deals with domestic policy issues? A. The department of defense B. The state department C. The environmental protection agenc
Completa este dialogo sobre el pasaporte de Marcos. Escribe tres oraciones completas y usa pronombres de objeto directo. (Complete this dialog about Marcos'pass
joey is allowed $10 worth of music each month. This month he has spent within $3 of his allowance
How do you write it in an equation 14/7=2
How do you solve A pharmacist put 3.84 ounces of Vitamin pills into bottles she put 0.032 ounces of Vitamin pills into each bottles?
Use your table to work out what fraction of the fish are 50cm or more in length
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'