umurrieHbettytayla
umurrieHbettytayla umurrieHbettytayla
  • 02-06-2016
  • Biology
contestada

A lack of some basic biological requirement such as water, which produces a drive to obtain that requirement, is known as the?

Respuesta :

Аноним Аноним
  • 06-06-2016
Drive reduction approach to motivation, this theory states that when an individual has been deprived of biological resources such as energy, water or sleep, others. They tend to result to impulse or drive. These basic needs arise an action to obtain this need is required. 
Answer Link

Otras preguntas

4x - 8 = 32 ?!!!! please help me plss
An error in the ending inventory balance in Year 1 will also affect: (You may select more than one answer. Single click the box with the question mark to produc
Which statement best summarizes the characters’ relationship in the scene? A. Robert is preparing for a three-year journey with his uncle. His brother, Andrew
PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!
Why is it important that courts create the expectation that business will be conducted fairly?
Solve for x and y.?? having trouble
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
what is the value of a in the equation ax + b = c
Is it hazard or risk
21 of 33 L Save & Exit Energy Changes in Chemical Reactions: Tutorial Question Draw the chemical reaction energy diagram for the synthesis of water. Then us