phippjor000 phippjor000

03-10-2019
Mathematics

contestada

The ratio of boys to girls in history class is 4 to 5. How many girls are in the class if there are 12 in the class?

Respuesta :

andrewpaz0922 andrewpaz0922

03-10-2019

Answer:

FEDFSFEW

Step-by-step explanation:

Answer Link

Otras preguntas

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The element with the most stable nucleus and smallest mass per particle is

The dodecahedron can be constructed from the repetitive folding of _____. A. equilateral triangles B. squares C. triangles D. regular pentagons

*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe

How did the Hellenistic kings spread Greek culture

A sharp type of pain from the abdomen that travels along neural routes

plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.

According to Christian teaching, Jesus taught in ________________or short stories that used analogies to tell religious truth. Stories Analogies Metaphors Parab

Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?