jaychavez1926 jaychavez1926

01-04-2019
Mathematics

contestada

what is the value of m in the equation 4(m-2)=24

Respuesta :

bobo3eo bobo3eo

01-04-2019

26-2= 24 there your answer

Answer Link

RoyalQueen12 RoyalQueen12

01-04-2019

SO, this is the way I learned it

4(m-2)=24

Distribute 4 into the parentheses

4m-8=24

Add 8 on both sides

4m=32

Divide by 4 on both sides

M=8

Answer Link

Otras preguntas

An account earns simple interest. Find the annual interest rate, I= $60 P= $500 t= 2 years

why is derek miller's social media post different than most?

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x

Which type of health insurance plan is not considered a managed care plan?

How do you find x ????

On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .

Which quotation from the text best supports the inference that the people of the sac nation do not typically challenge authority? "if he declared war he must le

stuck i need help please

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf